Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Irsyad Ibadurrahman; Suryani; Desriani

doi:10.1186/s43141-023-00580-z

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

J Genet Eng Biotechnol. 2023 Dec 18;21(1):168. doi: 10.1186/s43141-023-00580-z.

Authors

Irsyad Ibadurrahman^{1

2}, Suryani¹, Desriani³

Affiliations

¹ Biochemistry Department, IPB University, Jl. Raya Dramaga, Babakan, Bogor, West Java, 16680, Indonesia.
² Research Center for Genetic Engineering, Research Organization for Life Sciences and Environment, National Research and Innovation Agency, Jl Raya Cibinong KM 46, Bogor, West Java, 16191, Indonesia.
³ Research Center for Genetic Engineering, Research Organization for Life Sciences and Environment, National Research and Innovation Agency, Jl Raya Cibinong KM 46, Bogor, West Java, 16191, Indonesia. desrianilipi@gmail.com.

Abstract

Background: The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC).

Result: The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500-5,000, 6,500-7,500, and 23,300-25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests.

Conclusion: This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

Keywords: COVID-19; Primer design; RT-LAMP; SARS-CoV-2.

Abstract

Grants and funding