Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families

Hum Genomics. 2023 Dec 8;17(1):111. doi: 10.1186/s40246-023-00559-4.

Abstract

Background: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.

Results: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major.

Conclusion: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Keywords: Novel mutations; Premature termination; Truncated peptide; β-Thalassemia; β-Thalassemia trait.

MeSH terms

  • China
  • Female
  • Humans
  • Mutation
  • Pregnancy
  • Prenatal Diagnosis
  • Sequence Deletion / genetics
  • beta-Globins / genetics
  • beta-Thalassemia* / genetics

Substances

  • beta-Globins