Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.
Keywords: Causal Agent; Crop Type; Etiology; Field crops; Nematodes; Subject Areas; other.