Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia

Lily Zhang; Xiao Mao; Hongyu Long; Bo Xiao; Zhaohui Luo; Wenbiao Xiao; Xingbing Jin

doi:10.3389/fgene.2020.00564

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia

Front Genet. 2020 Jun 16:11:564. doi: 10.3389/fgene.2020.00564. eCollection 2020.

Authors

Lily Zhang¹, Xiao Mao², Hongyu Long¹, Bo Xiao¹, Zhaohui Luo¹, Wenbiao Xiao¹, Xingbing Jin³

Affiliations

¹ Neurology Department, Xiangya Hospital, Central South University, Changsha, China.
² Department of Medical Genetics, Maternal and Child Health Hospital of Hunan Province, Changsha, China.
³ Neurosurgery Department, Xiangya Hospital, Central South University, Changsha, China.

Abstract

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50^∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

Keywords: congenital disorders of glycosylation; glycosylphosphatidylinositol; infantile spasms; intellectual disability; phosphatidylinositol glycan class S; whole-exome sequencing.