Finding of novel telomeric repeats and their distribution in the human genome

Sathyalakshmi Alaguponniah; Deepa Velayudhan Krishna; Sayan Paul; Johnson Retnaraj Samuel Selvan Christyraj; Krishnan Nallaperumal; Sudhakar Sivasubramaniam

doi:10.1016/j.ygeno.2020.04.010

Finding of novel telomeric repeats and their distribution in the human genome

Genomics. 2020 Sep;112(5):3565-3570. doi: 10.1016/j.ygeno.2020.04.010. Epub 2020 Apr 19.

Authors

Sathyalakshmi Alaguponniah¹, Deepa Velayudhan Krishna¹, Sayan Paul², Johnson Retnaraj Samuel Selvan Christyraj³, Krishnan Nallaperumal¹, Sudhakar Sivasubramaniam⁴

Affiliations

¹ Centre for Information Technology & Engineering, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012, India.
² Department of Biotechnology, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012, India.
³ Department of Biotechnology, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012, India; Centre for Nanoscience and Nanotechnology, Sathyabama Institute of Science and Technology, Chennai, Tamilnadu 600 119, India.
⁴ Department of Biotechnology, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012, India. Electronic address: sudhakar@msuniv.ac.in.

PMID: 32320819
DOI: 10.1016/j.ygeno.2020.04.010

Abstract

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Keywords: Aging; Loop; Novel repeats; Telomere.

Publication types

Research Support, Non-U.S. Gov't

MeSH terms

Chromosomes, Human, Pair 11
Chromosomes, Human, Pair 2
DNA / chemistry
Genome, Human*
Humans
Repetitive Sequences, Nucleic Acid*
Telomere / chemistry*

Substances

DNA