Background: The SLC22A2 gene is a polyspecific transporter that mediates the electrogenic transport of small organic cations with different molecular structures. Furthermore, single-nucleotide polymorphisms (SNPs) of SLC22A2 are clinically significant because they can alter the transport of substrate drugs and may, thus, influence the efficacy and toxicity thereof. Additionally, further studies have reported that SLC22A2 is responsible for 80% of the total metformin clearance. Therefore, loss-of-function variants of SLC22A2 could affect the pharmacokinetic and pharmacodynamic characteristics of metformin. Although it is widely accepted that African populations harbor a greater amount of genomic diversity compared to other populations, limited information is available regarding genetic polymorphisms in SLC genes among African populations, specifically those related to impaired functional activity of hOCT2. Therefore, the aim of this study was to map known impaired function variants in the SLC22A2 gene.
Methods: Development of multiplex SNaPshot™ genotyping assay for 20 previously reported SLC22A2 nonsynonymous SNPs and the assessment of baseline allele frequencies of these variants in 140 Cape Admixed, 148 Xhosa and 152 Zulu individuals residing in Cape Town, South Africa.
Results: We identified three nonsynonymous SNPs, namely, A270S, R400C and K432Q in the population studied at minor allele frequencies of 6.1%, 3.4% and 0.7%, respectively. The most frequently observed haplotypes across all three populations were CATAATGCGTACGCGCGACG (~85%), CATAATGATTACGCGCGACG (~7%) and CATAATGAGTACGCGCGACG (~4.5%).
Conclusions: In addition to SNPs, the haplotypes identified in this study can in future also aid in identifying associations between causative genetic variants and drug response. This study contributes in filling the gap that exists with regards to genetic information about important variations in organic cation transporter genes for the indigenous populations of South Africa.