Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My NCBI Filters

Text availability

Article attribute

Article type

Publication date

Search Results

45 results

Filters applied: . Clear all
Results are displayed in a computed author sort order. The Results By Year timeline is not available.
Page 1
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ. Rizo-de-la-Torre LC, et al. Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. Epub 2017 Jun 12. Int J Lab Hematol. 2017. PMID: 28603845
Association of polymorphisms of the TNFRSF11B and TNFSF11 genes with bone mineral density in postmenopausal women from western Mexico.
González-Mercado A, Sánchez-López JY, Perea-Díaz FJ, Magaña-Torres MT, Salazar-Páramo M, González-López L, González-Mercado MG, Ibarra-Cortés B. González-Mercado A, et al. Arch Med Sci. 2019 Sep;15(5):1352-1356. doi: 10.5114/aoms.2019.87410. Epub 2019 Aug 22. Arch Med Sci. 2019. PMID: 31572484 Free PMC article. No abstract available.
Association between rs61764370, rs9266, and rs140080026 polymorphisms of the KRAS gene and breast cancer risk in a Mexican population.
Gallegos-Arreola MP, García Verdín PM, Magaña-Torres MT, Figuera LE, Zúñiga-González GM, Rosales-Reynoso MA, Gómez-Meda BC, Puebla-Pérez AM. Gallegos-Arreola MP, et al. Among authors: magana torres mt. Eur Rev Med Pharmacol Sci. 2021 Nov;25(21):6454-6464. doi: 10.26355/eurrev_202111_27088. Eur Rev Med Pharmacol Sci. 2021. PMID: 34787849 Free article.
Prevalence of the BRAF p.v600e variant in patients with colorectal cancer from Mexico and its estimated frequency in Latin American and Caribbean populations.
Hernández-Sandoval JA, Gutiérrez-Angulo M, Magaña-Torres MT, Alvizo-Rodríguez CR, Ramírez-Plascencia HHF, Flores-López BA, Valenzuela-Pérez JA, Peregrina-Sandoval J, Moreno-Ortiz JM, Domínguez-Valentín M, Ayala-Madrigal ML. Hernández-Sandoval JA, et al. J Investig Med. 2020 Jun;68(5):985-991. doi: 10.1136/jim-2020-001301. Epub 2020 Mar 16. J Investig Med. 2020. PMID: 32184228 Free PMC article.
45 results