Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My NCBI Filters

Text availability

Article attribute

Article type

Publication date

Search Results

33 results

Filters applied: . Clear all
Results are displayed in a computed author sort order. The Results By Year timeline is not available.
Page 1
Molecular spectrum of beta-thalassemia in the Mexican population.
Perea FJ, Magaña MT, Cobián JG, Sánchez-López JY, Chávez ML, Zamudio G, Esparza MA, López-Guido B, Ibarra B. Perea FJ, et al. Blood Cells Mol Dis. 2004 Sep-Oct;33(2):150-2. doi: 10.1016/j.bcmd.2004.06.001. Blood Cells Mol Dis. 2004. PMID: 15315794
Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).
de-la-Cruz-Salcedo EI, Ibarra B, Rizo-de-la-Torre LC, Sánchez-López JY, González-Mercado A, Harteveld CL, Perea-Díaz FJ. de-la-Cruz-Salcedo EI, et al. Int J Lab Hematol. 2016 Oct;38(5):535-42. doi: 10.1111/ijlh.12536. Epub 2016 Jun 24. Int J Lab Hematol. 2016. PMID: 27339814
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ. Rizo-de-la-Torre LC, et al. Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. Epub 2017 Jun 12. Int J Lab Hematol. 2017. PMID: 28603845
33 results