alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides

F Morvan; B Rayner; J P Leonetti; J L Imbach

doi:10.1093/nar/16.3.833

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides

Nucleic Acids Res. 1988 Feb 11;16(3):833-47. doi: 10.1093/nar/16.3.833.

Authors

F Morvan¹, B Rayner, J P Leonetti, J L Imbach

Affiliation

¹ Laboratoire de Chimie Bio-Organique, UA 488 CNRS, Montpellier, France.

Abstract

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

Publication types

Research Support, Non-U.S. Gov't

MeSH terms

Base Sequence
Chromatography, High Pressure Liquid
Molecular Conformation
Oligodeoxyribonucleotides / chemical synthesis*

Substances

Oligodeoxyribonucleotides