In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.
Keywords: DNA complemented palindrome; complemented palindromic small RNA; palindromic small RNA; severe acute respiratory syndrome coronavirus; small RNA.